Skip to content

szpital tarnów urologia ad

1 miesiąc ago

491 words

Próbki pobierano od pacjentów przez dwa lub więcej dni. Wszyscy pacjenci mieli trwałą hipofosfatemię; niska maksymalna reabsorpcja fosforanu nerkowego, znormalizowana według wskaźnika filtracji kłębuszkowej; normalne zjonizowane stężenia wapnia w surowicy; i normalne stężenia parathormonu w osoczu. Maksymalna reabsorpcja fosforanu nerkowego, znormalizowana według współczynnika filtracji kłębuszkowej, została określona za pomocą nomogramu opisanego przez Waltona i Bijvoët.22 Wykrywanie mutacji
Użyliśmy intronów intronowych do amplifikacji 13 egzonów genu NPT2a. Region 190 pz powyżej eksonu również został zsekwencjonowany. Egzony 3 i 5 zamplifikowano za pomocą następujących primerów: ekson 3, 5 CCGCCTGTTCCTCCCCGCCTC (górny starter), 5 CCATGAGCATAGTGGGGCAGAG (niższy starter); ekson 5, 5 AGGAGACCTGGGAGGGGTTCC (górny starter), 5 AAGCTCTTCCCCACCCTGG (dolny starter). Amplifikację prowadzono przez 35 cykli w temperaturze hybrydyzacji 60 ° C. Sekwencja innych primerów jest dostępna jako Dodatek Dodatek wraz z pełnym tekstem tego artykułu na stronie http://www.nejm.org. Produkty PCR sekwencjonowano za pomocą zestawu gotowości do reakcji na sekwencję cyklizacji BigDye Terminator (Perkin-Elmer) na sekwenatorze ABI PRISM 3100 (Applied Biosystems). Przeanalizowaliśmy obie nici DNA przy użyciu programów do analizy sekwencji (Applied Biosystems) i Clustal W (Infobiogen).
Ekspresja NPT2a w Oocytach Xenopus laevis
Komplementarny DNA typu dzikiego (cDNA) kodujący ludzką NPT2a (udostępniony przez dr J. J. Bibera i H. Mürera, Instytut Fizjologii, Uniwersytet w Zurychu, Zurych) został wprowadzony do wektora ekspresyjnego pSP64T23,24 pomiędzy miejscami XhoI i NotI . Zmutowany cDNA uzyskano z konstruktu typu dzikiego przy użyciu zestawu do szybkiej mutagenezy (Stratagene), zgodnie z instrukcjami producenta. Wszystkie konstrukty zweryfikowano przez sekwencjonowanie. RNA zsyntetyzowano za pomocą zestawu Riboprobe in Vitro Transcription System (Promega) z polimerazą RNA SP6. Otrzymano trzy niezależne preparaty RNA dla każdego konstruktu, każdy z innego preparatu plazmidu. Oczyszczone RNA oznaczono ilościowo przez absorpcję przy 260 nm, a jakość zweryfikowano przez obliczenie stosunku odczytów przy 260 i 280 nm (A260 / A280). Homogenność i oznaczanie ilościowe wszystkich preparatów stosowanych do iniekcji oocytów kontrolowano za pomocą elektroforezy w żelu agarozowym.
Defilikulowane komórki jajowe (stadium V lub VI) z X. laevis uzyskano przy użyciu standardowych procedur i wstrzyknięto 24 godziny później wskazaną ilością RNA dzikiego lub zmutowanego w 50 nl wody lub samej wodzie. Oocyty inkubowano w 18 ° C w zmodyfikowanym roztworze Barth a (5 mM HEPES-wodorotlenek sodu [pH 7,5] zawierającym 85 mM chlorek sodu, mM chlorek potasu, mM chlorek wapnia, mM chlorek magnezu i penicylinę-streptomycynę). Zmierzono wychwyt fosforanu i przeprowadzono analizę clampowania napięcia w trzy dni po wstrzyknięciu.
Oocyty przepłukano w temperaturze pokojowej w roztworze wolnym od sodu (roztwór wychwytu bez zawartości sodu bez fosforu-32) i inkubowano z roztworem zawierającym sód (10 mM HEPES-TRIS [pH 7,5] zawierającym 96 mM chlorku sodu, 2 mM chlorek potasu, 1,8 mM chlorek wapnia, mM chlorek magnezu, 0,1 mM fosforan potasu i 10 .C [32P] ortofosforanu na mililitr) lub z roztworem poboru nie zawierającym sodu (100 mM chlorek choliny zastąpiony chlorkiem sodu)
[więcej w: dyżury aptek sztum, kosmetyk definicja, przeglądarka skierowan do sanatorium ]
[więcej w: urolog warszawa nfz, endometrium po poronieniach, zniesiona lordoza szyjna objawy ]

0 thoughts on “szpital tarnów urologia ad”